First Report of Grapevine Enamovirus 1 in <i>Vitis vinifera</i> Cultivar Meunier in France

نویسندگان

چکیده

HomePlant DiseaseVol. 106, No. 2First Report of Grapevine Enamovirus 1 in Vitis vinifera Cultivar Meunier France PreviousNext DISEASE NOTE OPENOpen Access licenseFirst FranceJ. M. Hily, V. Komar, G. Mathieu, P. Mustin, A. S. Spilmont, Uriel, E. Vigne, and O. LemaireJ. Hily†Corresponding author: J. Hily; E-mail Address: [email protected]https://orcid.org/0000-0001-9141-9701IFV, Le Grau-Du-Roi, FranceSearch for more papers by this author, KomarUniversité de Strasbourg, INRAE, SVQV UMR-A 1131, F-68000 Colmar, MathieuIFV, MustinUniversité SpilmontIFV, UrielComité Champagne, Epernay, Vignehttps://orcid.org/0000-0002-3287-0786Université LemaireUniversité authorAffiliationsAuthors Affiliations Hily1 † Komar2 Mathieu1 Mustin2 Spilmont1 Uriel3 Vigne2 Lemaire2 1IFV, 2Université 3Comité Published Online:27 Jan 2022https://doi.org/10.1094/PDIS-07-21-1416-PDNAboutSectionsPDF ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat enamovirus (GEV-1) is a member the genus family Solemoviridae. GEV-1 was first described 2017 few grapevine cultivars Brazil (Silva et al. 2017) subsequently China (Ren 2021). We identified using high-throughput sequencing (HTS) (Illumina, NOVASeq SP, TruSeq mRNA stranded 2 × 150 bp ribosomal RNA depleted total extracts an RNeasy Plant mini kit) (Qiagen) from ‘Meunier’ leaf sample collected than 20-year-old commercial vineyard Champagne region 2019. Analyses 47,573,330 reads were performed CLC Genomics Workbench 12.0 software as previously (Hily 2018). The genome, determined only HTS data (isolate GEV-1-Fr; GenBank accession no. MW760844), 6,262 nucleotides (nt) long fully covered with 5,706 (mapping parameters 0.5 length 0.7 similarity fractions CLC). Compared sequences (NC_034836 KX645875) Brazil, GEV-1-Fr sequence contained indels, including deletion 9 nt 5? untranslated (UTR), insertion 3 located overlapping open reading frame (ORF)1 ORF2, single noncoding between ORF2 ORF3. These indels also exist within isolate SD-CG (MT536978). However, contains unique 45-nt 3?-UTR, although needs be verified standard assays. Overall, exhibits 88.7, 89.1, 93.3% identity at level isolates (NC_034836, (MT536978), respectively. GEV-1-infected showed symptoms light chlorotic patterns on leaves that probably due presence other coinfecting viruses, fanleaf virus, Pinot gris rupestris stem pitting-associated fleck virus. detection further confirmed via RT-PCR newly designed primer pairs Fwd_GEV_5600 (GCAAGGAGCAGCCCTATAATGCT) Rev_GEV_6075 (CTAGTCGATACGATCTATAGGCGAGG) amplified 474-bp fragment ORF5. TaqMan assay OFR5 following primers probe: Fwd_GEV_5662 (ACAAGTGCCYGTTTCCATAG), Probe_GEV_5724-FAM (TTTACCGAGGACTATGACGCCGC), Rev_GEV_5772 (CACCGGCTCCATAACCATT). Among all samples different geographic regions tested (n = 188), original plant positive GEV-1. To our knowledge, report European vineyards general. Although many aspects virus biology are yet elucidated, results expand its geographical range. New can developed, considering genetic diversity, facilitate define evolutionary history.The author(s) declare no conflict interest.References:Hily, J.-M., 2018. Biotechnol. 16:208. https://doi.org/10.1111/pbi.12761 Crossref, ISI, Google ScholarRen, F., 2021. Pathol. 103:349. https://doi.org/10.1007/s42161-020-00674-4 ScholarSilva, 2017. Virus Genes 53:667. https://doi.org/10.1007/s11262-017-1470-y ScholarFunding: This work supported Institut National Recherche pour l’Agriculture, l’Alimentation l’Environnement (INRAE), Français la Vigne du Vin (IFV), ‘Plan Dépérissement Vignoble’ (French Ministry Agriculture) projects ‘VACCIVINE’ ‘GPGV’ 2019, respectively.The interest.DetailsFiguresLiterature CitedRelated Vol. February 2022SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionWater-soaked lesions bougainvillea caused Robbsia andropogonis (O. Morales-Galván al.). Photo credit: L. F. Flores-López. Soybean showing crinkling downward curling, characteristic infection soybean mosaic (SMV) (S. van Bentum Bentum. Metrics Article History Issue Date: 28 Feb 2022Published: 27 2022First Look: 22 Aug 2021Accepted: 19 2021 Page: 774 Information© 2022 American Phytopathological SocietyFundingInstitut l’AgricultureInstitut (IFV),Plan VignobleGrant/Award Number: VACCIVINEGrant/Award GPGVKeywordsgrapevinegrapevine 1complete sequencehigh-throughput sequencingThe interest.PDF downloadCited byGrapevine 1CABI Compendium, CABI Compendium

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Grapevine yellows affecting the Croatian indigenous grapevine cultivar Grk

The grapevine cultivar Grk, a close relative of Crljenak ka{telanski/Zinfandel, is grown exclusively in southern Croatia. Grapevine yellows-like symptoms were observed on vines in the vineyards in Lumbarda (southern Croatia) and in propagated grapevines near Zadar and Zagreb. The majority of the detected phytoplasma isolates belonged to the 16SrI group. However, RFLP pattern and R16F2n/R2 fragm...

متن کامل

analyzing patterns of classroom interaction in efl classrooms in iran

با به کار گیری روش گفتما ن شنا سی در تحقیق حا ضر گفتا ر میا ن آموزگا را ن و زبا ن آموزا ن در کلا سهای زبا ن انگلیسی در ایرا ن مورد بررسی قرار گرفت. ا هداف تحقیق عبا رت بودند از: الف) شنا سا ئی سا ختارهای ارتبا ط گفتا ری میا ن معلمین و زبا ن آموزا ن ب) بررسی تا ثیر نقش جنسیت دبیرا ن و زبا ن آموزان بر سا ختا رهای ارتبا ط گفتا ری میا ن آنها پ) مشخص کردن اینکه آ یا آموزگاران غا لب بر این ارتبا ط گف...

First report of Kirramyces epicoccoides in Iran

During year 2008–11, some infected leaves of eucalypt trees (Eucalyptus camaldulensis Dehnh.) having blight and spot symptoms were collected in Golestan province (N Iran). The necrotic spots were appeared on both surfaces of the leaves and were circular to irregular, single to confluent, medium brown to light brown with red brown margin (Fig. 1A & B). In some cases, young leaves have been sever...

متن کامل

First report of Rhizopogon roseolus in Iran

Rhizopogon is a hypogeous fungal genus that grows in an ectomycorrhizal symbiosis mostly with members of the Pinaceae family and its worldwide distribution correlates with natural and exotic Pinaceae forests. In Iran, Rhizopogon species have received scant attention from collectors in the past and have not been adequately collected. Few older studies, report the presence of R. luteolus (Saber 1...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Plant Disease

سال: 2022

ISSN: ['0191-2917', '1943-7692']

DOI: https://doi.org/10.1094/pdis-07-21-1416-pdn